search
Product Information
Phase Detail
Clarity QSP
Clarity QSP 96-well plate and buffer system allows for purification of trityl on synthetic RNA and DNA
Clarity QSP
Clarity QSP
High-Throughput Purification
Purify trityl on synthetic DNA or RNA samples in 20 minutes using Clarity QSP 96-well plate and buffer system. Final elution delivers >90 % typical purities/recoveries for in vivo applications and downstream analysis by LC-MS or CE.
- Formats offer easy high-throughput processing for parallel purifications
- Simple three step process delivers highly purified DNA/RNA in minutes
- For oligos 10-100 mer
- Economical and disposable format
U.S. Patent No. 7,119,145
General Extraction
| Formats | |
|---|---|
| Oligo Chemistry | 96-Well Plates and 3 mL Cartridges |
| Synthesis Scale Load | DNA & RNA |
| Oligo Length |
|
| Typical Purity1 | ≤ 100 nt |
| Typical Recovery Yield2 | ≥ 90 % |
| Typical Recovery Yield2 | ≥ 80 % |
| Purification Time | ~ 8 minutes/ cartridge ~ 45 minutes/ well plate (96 samples) |
| Equipment Required | Positive pressure manifold, vacuum manifold, or automated liquid handling system |
1 Purity value based on ion-exchange chromatography and capillary electrophoresis
2 OD260 used for quantitation
It’s Quick, Simple, and Pure (QSP)
Pre-treatment
Trityl-on oligo sample preparation. Mix equal volume of loading buffer with cleavage/deprotection solution
Clarity QSP 96-well plate with DNA Buffer
Crude 30 mer DNA- 200 nmole Sequence: GTGGATCTGCGCACTTCAGGCTCCTGGGCG
Sample Preparation:
- 250 µL of oligo solution in concentrated NH2OH (post deprotection) was aliquoted
- An equal volume of DNA buffer (250 µL) was added and vortexed
Condition:
1 mL Methanol (2 x 0.5 mL) |
Equilibrate:
1 mL Water (2 x 0.5 mL) |
Load:
Oligo Sample (500 µL) |
Detritylate:
1 mL 1 % DCA |
Rinse:
1 mL Water (2 x 0.5 mL) |
Dry Sorbent:
at 10” Hg Vacuum (~1 min) |
Elute:
1 mL 15 mM Na2CO3/ 20 % Acetonitrile |
| Crude Trityl-on | Load Fraction | Detritylated Final Elution | Recovery | Purity (Peak area) |
|---|---|---|---|---|
| 28.3 | 5.3 | 20.8 | 90.3 % | 92 % |
Phenomenex is a technology leader committed to developing novel analytical chemistry solutions that solve the separation and purification challenges of researchers worldwide
Phenomenex is a technology leader committed to developing novel analytical chemistry solutions that solve the separation and purification challenges of researchers worldwide